Sequence ID | >WENV170016303 |
Genome ID | AZIJ01022871 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 2128 |
End posion on genome | 2044 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gagacctttt |
tRNA gene sequence |
GCGGGCGTGGCGGAATTGGTAGACGCGCTGGATTTAGGTTCCAGTGCCGCAAGGCGTGGG |
Downstream region at tRNA end position |
cgccggaagc |
Secondary structure (Cloverleaf model) | >WENV170016303 Leu TAG t ACCA cgccggaagc G - C C - G G - C G - C G - C C - G G - C T G T C T C C C A T A A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TGCCGCAAGGCGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |