Sequence ID | >WENV170016315 |
Genome ID | AZIJ01023165 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 8120 |
End posion on genome | 8045 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ccgcacggtc |
tRNA gene sequence |
GCCCTTGTAGCTCAGTTGGTAGAGCACCTGATTTGTAATCAGGGGGTCACGGGTTCGAAT |
Downstream region at tRNA end position |
tttgcaatca |
Secondary structure (Cloverleaf model) | >WENV170016315 Thr TGT c ACCG tttgcaatca G - C C - G C - G C - G T + G T + G G - C T A T T G T C C A T G A A | | + | | G T C T C G A C G G G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |