Sequence ID | >WENV170016347 |
Genome ID | AZIK01000769 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 261288 |
End posion on genome | 261198 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtctcggttc |
tRNA gene sequence |
GGAGGGATGGCTGAGCGGTTGAAAGCACCGGTCTTGAAAACCGGCATAGGTTAATAGCCT |
Downstream region at tRNA end position |
cttattttaa |
Secondary structure (Cloverleaf model) | >WENV170016347 Ser TGA c GCCA cttattttaa G - C G - C A - T G - C G - C G - C A - T T A T A T C C C A C G A G | | | | | A G G T C G T A G G G C G | | | T T T A A G C T G A A CATAGGTTAATAGCCTATC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |