Sequence ID | >WENV170016366 |
Genome ID | AZIK01001308 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1997 |
End posion on genome | 1921 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccagttttga |
tRNA gene sequence |
TGCGGGGTGGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTTGGTTCGAA |
Downstream region at tRNA end position |
ctatataaac |
Secondary structure (Cloverleaf model) | >WENV170016366 Met CAT a ACCA ctatataaac T T G - C C - G G - C G - C G - C G - C T A T C G A C C A T G A G | + | | | G C C G A G G T T G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |