Sequence ID | >WENV170016375 |
Genome ID | AZIK01001905 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 42504 |
End posion on genome | 42418 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tgctcttcct |
tRNA gene sequence |
GCGGGTATGGTGAAATTGGTAGACACAACAGACTTAAAATCTGTCGACCGTTAGGTCATG |
Downstream region at tRNA end position |
ctttcctttt |
Secondary structure (Cloverleaf model) | >WENV170016375 Leu TAA t ACCA ctttcctttt G - C C - G G - C G - C G - C T - A A - T T G T C G G C C A T A A G | | | | | A T A G T G G C C G G C G | | | T T G A C A C T A G A CGACCGTTAGGTCAT A - T C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |