Sequence ID | >WENV170016388 |
Genome ID | AZIK01002315 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 2463 |
End posion on genome | 2388 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cgaaattcgt |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGGAGAGCACCTGTTTTGCAAGCAGGGGGTCAAGAGTTCGAAT |
Downstream region at tRNA end position |
tttttgttct |
Secondary structure (Cloverleaf model) | >WENV170016388 Ala TGC t ACCA tttttgttct G - C G - C G + T G - C G + T T - A A - T T A T T T C T C A T G A A | | | | | G T C T C G A A G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C T + G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |