Sequence ID | >WENV170016390 |
Genome ID | AZIK01002464 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 177 |
End posion on genome | 261 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taagaatgct |
tRNA gene sequence |
GCCCGGGTGGTGAAACTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCCGTGCC |
Downstream region at tRNA end position |
tattagaaga |
Secondary structure (Cloverleaf model) | >WENV170016390 Leu GAG t ACCA tattagaaga G - C C - G C - G C - G G - C G - C G - C T G T C G G C C A C A A G | | | | | G T A G T G G C C G G C G | | | T T G A C A C T A G G TGGCGAAAGCCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |