Sequence ID | >WENV170016391 |
Genome ID | AZIK01002650 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 746 |
End posion on genome | 670 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ccctcacggt |
tRNA gene sequence |
CGGGCTGTAGCGCAGCCTGGTAGCGCACCTGCTTCGGGAGCAGGGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
atttcaaaca |
Secondary structure (Cloverleaf model) | >WENV170016391 Pro CGG t ACCA atttcaaaca C - G G - C G - C G - C C - G T - A G - C T A T T C T C C A C G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A G - C C - G T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |