Sequence ID | >WENV170016399 |
Genome ID | AZIK01003013 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 56 |
End posion on genome | 132 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gccacaatat |
tRNA gene sequence |
AGGACTATAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGGCGGTTCGAG |
Downstream region at tRNA end position |
gaattgcaaa |
Secondary structure (Cloverleaf model) | >WENV170016399 Val GAC t ACCA gaattgcaaa A - T G - C G - C A - T C - G T - A A - T T G T C C G C C A T G A A | | | | | G T C T C G G G C G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |