Sequence ID | >WENV170016403 |
Genome ID | AZIK01003104 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 540 |
End posion on genome | 617 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
attaattttt |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCCGGTTATCGCGCCTCGTTTGGGACGAGGAGGTCGCAGGTTCGA |
Downstream region at tRNA end position |
tacttagaaa |
Secondary structure (Cloverleaf model) | >WENV170016403 Pro TGG t ACAA tacttagaaa C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A C C G A A | | | | | G C T G C G G C A G G C G | | | T T G T C G C T T A G AGGTC C - G C - G T - A C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |