Sequence ID | >WENV170016414 |
Genome ID | AZIK01004026 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 3607 |
End posion on genome | 3531 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcattggtag |
tRNA gene sequence |
GGGCCTGTAGCTCAATTGGTTAGAGCAGAGCGCTCATAACGCTTTGGTTGCGGGTTCAAG |
Downstream region at tRNA end position |
aacctctttc |
Secondary structure (Cloverleaf model) | >WENV170016414 Met CAT g ACCA aacctctttc G + T G - C G - C C - G C - G T + G G - C T G T C G T C C A T A A A | | + | | A T C T C G G C G G G C G | | | | T T G G A G C T T A A TGGTT G + T A - T G - C C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |