Sequence ID | >WENV170016422 |
Genome ID | AZIK01004338 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 579 |
End posion on genome | 503 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gaaagcacgt |
tRNA gene sequence |
GGCAATATAGCTCAGTTGGTTAGAGCAACGCATTCATAATGCGTGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
gttttcagca |
Secondary structure (Cloverleaf model) | >WENV170016422 Met CAT t ACCA gttttcagca G - C G - C C - G A - T A - T T - A A - T T A T C G C C C A T G A A | | | | G T C T C G G C A G G C G | | | | T T G G A G C T T A A GGGTC A - T C - G G - C C - G A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |