Sequence ID | >WENV170016445 |
Genome ID | AZIK01005590 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 108 |
End posion on genome | 183 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
attatgcagt |
tRNA gene sequence |
AGGCCAGTAGCTCAATTGGCAGAGCAGCGGTCTCCAAAACCGCAGGTTGGGGGTTCGATT |
Downstream region at tRNA end position |
cctccagtcg |
Secondary structure (Cloverleaf model) | >WENV170016445 Trp CCA t GCCA cctccagtcg A - T G - C G - C C - G C - G A - T G - C T T T C T C C C A T A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |