Sequence ID | >WENV170016457 |
Genome ID | AZIK01006394 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 2583 |
End posion on genome | 2658 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gcgaatgtga |
tRNA gene sequence |
GCTGGCGTAGCTCAGTTGGTAGAGCAGCTGACTTGTAATCAGCAGGTCGGGGGTTCGATT |
Downstream region at tRNA end position |
ctttttagtt |
Secondary structure (Cloverleaf model) | >WENV170016457 Thr TGT a TCCA ctttttagtt G - C C - G T - A G - C G - C C - G G - C T T T C T G C C A T G A A | + | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |