Sequence ID | >WENV170016462 |
Genome ID | AZIK01006644 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1878 |
End posion on genome | 1802 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ggccgttgat |
tRNA gene sequence |
CGGCGTGTGGCGCAGCTTGGTAGCGCACTTCGTTCGGGACGAAGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
ctttcccgcc |
Secondary structure (Cloverleaf model) | >WENV170016462 Pro CGG t ACCA ctttcccgcc C - G G - C G - C C - G G - C T - A G - C T A T C G T C C A C G A G | | | | | G T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |