Sequence ID | >WENV170016488 |
Genome ID | AZIK01009156 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 36811 |
End posion on genome | 36735 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
acagcaagct |
tRNA gene sequence |
CGGGGTATAGCGCAGTCTGGTAGCGCGCCTGGTTTGGGACCAGGATGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
aattttaaaa |
Secondary structure (Cloverleaf model) | >WENV170016488 Pro TGG t ACCA aattttaaaa C - G G - C G - C G - C G - C T - A A - T T A T C T C T C A T G A A | + | | | G C C G C G G G G A G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |