Sequence ID | >WENV170016492 |
Genome ID | AZIK01009775 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 589 |
End posion on genome | 664 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
agagaagagt |
tRNA gene sequence |
GCCGCTGTAGCTCAGCTGGTAGAGCACGTCATTCGTAATGATGGGGTCGTAGGTTCGAGT |
Downstream region at tRNA end position |
cttttctatt |
Secondary structure (Cloverleaf model) | >WENV170016492 Thr CGT t ACCA cttttctatt G - C C - G C - G G - C C - G T - A G - C T G T T A T C C A C G A A + | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A A GGGTC C - G G + T T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |