Sequence ID | >WENV170016501 |
Genome ID | AZIK01010783 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 284 |
End posion on genome | 360 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gacgttttat |
tRNA gene sequence |
GGGGGATTAGCTCAGCTGGCTAGAGCGCCTGCCTTGCACGCAGGAGGTCATCGGTTCGAC |
Downstream region at tRNA end position |
ttagatacat |
Secondary structure (Cloverleaf model) | >WENV170016501 Ala TGC t ACAA ttagatacat G - C G - C G + T G - C G + T A - T T - A T C T T A G C C A C G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C T A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |