Sequence ID | >WENV170016506 |
Genome ID | AZIK01011125 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 295 |
End posion on genome | 219 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
acgccgcaac |
tRNA gene sequence |
GGATTGGTAGCTCAGTTGGATAGAGCACTTGACTACGAATCAAGGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
cttctgcctt |
Secondary structure (Cloverleaf model) | >WENV170016506 Arg ACG c GCCA cttctgcctt G - C G - C A - T T + G T - A G - C G - C T A T C C T C C A T G A A | | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GGGTC C - G T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |