Sequence ID | >WENV170016517 |
Genome ID | AZIK01011467 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 3810 |
End posion on genome | 3734 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tatgtgaagt |
tRNA gene sequence |
GGCTATGTAGCTCAGCTGGTTAGAGCACAGCATTCATAATGCTGGGGTCGATGGTTCAAG |
Downstream region at tRNA end position |
cttatttcta |
Secondary structure (Cloverleaf model) | >WENV170016517 Met CAT t ACCA cttatttcta G + T G - C C - G T - A A - T T - A G - C T G T C T G C C A C G A A | | + | | A T C T C G G A T G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T G - C C - G A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |