The detailed information of tRNA gene sequence


Sequence ID>WENV170017983
Genome IDBARV01002411
Search identical group
Phylum/Class[BARV] marine sediment metagenome; marine subsurface sediment at 48.5 meters below seafloor (mbsf), off the Shimokita Peninsula
Species
Start position on genome 860
End posion on genome 771
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
ttcaaagcta
tRNA gene sequence
GGAGGGGTGTCCGAGTGGTCTATGGTGACGGTCTTGAAAACCGTTGTTCCTGCAAGGGGA
CCGTGGGTTCGAATCCCACCCCCTCCGCCA
Downstream region at tRNA end position
ctatttatgg
Secondary structure (Cloverleaf model)
>WENV170017983	Ser	TGA
                   a      GCCA ctatttatgg
                     G - C
                     G - C
                     A - T
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C A C C C     A
      T G A        G      | | | | |     G
    G       G C C T       G T G G G     C
    G       + | |                   T T
    T       T G G T
      C T A        G     TGTTCCTGCAAGGGGACC
                    A - T
                    C - G
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK