| Sequence ID | >WENV170020803 |
| Genome ID | BBPE01031056 |
| Phylum/Class | [BBPE] groundwater metagenome; The Cedars highly-alkaline serpentinizing springs in California |
| Species | |
| Start position on genome | 501 |
| End posion on genome | 576 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
cgacatttat |
| tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGTCAAGAGTTCGAAT |
| Downstream region at tRNA end position |
gtaatatcaa |
| Secondary structure (Cloverleaf model) | >WENV170020803 Ala TGC
t ACCA gtaatatcaa
G - C
G - C
G + T
G - C
G + T
T - A
G - C T A
T T T C T C A
T G A A | | | | | G
T C T C G A A G A G C
G | | | | T T
G G A G C
G A A GGGTC
C - G
C - G
T - A
G - C
C - G
C A
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |