| Sequence ID | >WENV170028134 |
| Genome ID | CDYE01001899 |
| Phylum/Class | [CDYE] gut metagenome; human stools |
| Species | |
| Start position on genome | 58853 |
| End posion on genome | 58777 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
aacggttgac |
| tRNA gene sequence |
AGTCCTATAGCTCAGTTGGTTAGAGCGCTACACTGATAATGTAGAGGTCGGCAGTTCAAC |
| Downstream region at tRNA end position |
gttgaaaaac |
| Secondary structure (Cloverleaf model) | >WENV170028134 Ile GAT
c ACCA gttgaaaaac
A - T
G - C
T - A
C - G
C - G
T + G
A - T T C
T C C G T C A
T G A A | | | | | A
T C T C G G G C A G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
T - A
A - T
C - G
A - T
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |