The detailed information of tRNA gene sequence


Sequence ID>WENV170028289
Genome IDCDYE01006537
Search identical group
Phylum/Class[CDYE] gut metagenome; human stools
Species
Start position on genome 412
End posion on genome 336
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ggttttcaat
tRNA gene sequence
GGCGGCATAGCTCAGTTGGCTAGAGCATGCGGTTCATACCCGCAGTGTCCCCGGTTCAAA
TCCAGGTGCCGCTACCA
Downstream region at tRNA end position
gaccccaaaa
Secondary structure (Cloverleaf model)
>WENV170028289	Met	CAT
                   t      ACCA gaccccaaaa
                     G + T
                     G - C
                     C - G
                     G - C
                     G - C
                     C - G
                     A - T          T A
                    T     G G A C C     A
      T G A        A      | |   | |     A
    T       C T C G       C C C G G     C
    G       | | | |                 T T
    G       G A G C
      C T A        A     GTGTC
                    T - A
                    G - C
                    C - G
                    G - C
                    G - C
                  T       C
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK