| Sequence ID | >WENV170028292 |
| Genome ID | CDYE01006543 |
| Phylum/Class | [CDYE] gut metagenome; human stools |
| Species | |
| Start position on genome | 1140 |
| End posion on genome | 1068 |
| Amino Acid | Gly |
| Anticodon | CCC |
| Upstream region at tRNA start position |
aactggctaA |
| tRNA gene sequence |
GCAGATATAGTTCATTGGTAGAACATCAGCTTCCCAAGCTGAGGAGGCGGGTTCGATTCC |
| Downstream region at tRNA end position |
tttattgccc |
| Secondary structure (Cloverleaf model) | >WENV170028292 Gly CCC
A TTtt tttattgccc
G - C
C - G
A - T
G - C
A - T
T - A
A - T T T
T T G C C C A
T A A + | | | | G
T C T T G G C G G G C
G | | | | T T
G G A A C
T A A GGAG
T - A
C - G
A - T
G - C
C - G
T A
T A
C C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |