| Sequence ID | >WENV170028437 |
| Genome ID | CDYE01010243 |
| Phylum/Class | [CDYE] gut metagenome; human stools |
| Species | |
| Start position on genome | 382 |
| End posion on genome | 457 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
gcgcaaatat |
| tRNA gene sequence |
GCCATCTTAGCTCAACTGGTAGAGCAACCGTCTTGTAATCGGTAGGTTGGAGGTTCGATT |
| Downstream region at tRNA end position |
gagatgcccg |
| Secondary structure (Cloverleaf model) | >WENV170028437 Thr TGT
t TCCA gagatgcccg
G - C
C - G
C - G
A - T
T + G
C - G
T C T T
T C C T C C A
C A A A | | | | | G
T C T C G G G A G G C
G | | | | T T
G G A G C
T A A AGGTT
A - T
C - G
C - G
G - C
T T
C A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |