The detailed information of tRNA gene sequence


Sequence ID>WENV170037092
Genome IDCDYP01020430
Search identical group
Phylum/Class[CDYP] gut metagenome; human stools
Species
Start position on genome 205808
End posion on genome 205892
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
gaattattcc
tRNA gene sequence
GCGGATGTGGCGTAATTGGCAGCCGCGCCAGACTTAGGATCTGGTGCCGTGAGGCGTGTA
GGTTCGAGTCCTATCATCCGCACAA
Downstream region at tRNA end position
tccctataat
Secondary structure (Cloverleaf model)
>WENV170037092	Leu	TAG
                   c      ACAA tccctataat
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     T A T C C     A
      T A A        G      + | | | |     G
    T       T G C G       G T A G G     C
    G         | | |                 T T
    G       C C G C
      C A G        G     TGCCGTGAGGCGT
                    C - G
                    C - G
                    A - T
                    G - C
                    A - T
                  C       A
                  T       G
                    T A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK