| Sequence ID | >WENV170060194 |
| Genome ID | CDZH01078062 |
| Phylum/Class | [CDZH] gut metagenome; human stools |
| Species | |
| Start position on genome | 2229 |
| End posion on genome | 2304 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
ctggtcagac |
| tRNA gene sequence |
GCTGGTGTAGCTCAGCTGGTAGAGCAGCTGATTTGTAATCAGCAGGTCGGGGGTTCGAAT |
| Downstream region at tRNA end position |
atttcatann |
| Secondary structure (Cloverleaf model) | >WENV170060194 Thr TGT
c TCCA atttcatann
G - C
C - G
T - A
G - C
G - C
T - A
G - C T A
T C T G C C A
C G A A | + | | G
T C T C G G G G G G C
G | | | | T T
G G A G C
T A A AGGTC
G - C
C - G
T - A
G - C
A - T
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |