| Sequence ID | >WENV170111711 |
| Genome ID | CECJ01015444 |
| Phylum/Class | [CECJ] gut metagenome; human stools |
| Species | |
| Start position on genome | 2895 |
| End posion on genome | 2821 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
tatctatcat |
| tRNA gene sequence |
GGCCCTGTAGTTCAACGGATAGAATAGATGTTTCCTAAACATTAGATAGGGGTTCGATTC |
| Downstream region at tRNA end position |
caataaaacg |
| Secondary structure (Cloverleaf model) | >WENV170111711 Arg CCT
t ACAA caataaaacg
G + T
G - C
C - G
C - G
C - G
T + G
G - C T T
T T C C T C A
C A A A | | | + | G
G C T T G A G G G G C
G | | | + T T
A G A A T
T A A AGAT
G + T
A - T
T - A
G - C
T - A
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |