The detailed information of tRNA gene sequence


Sequence ID>WENV170199989
Genome IDCEPM01008168
Search identical group
Phylum/Class[CEPM] marine metagenome genome assembly TARA_038_SRF_0.1-0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx)
Species
Start position on genome 447
End posion on genome 360
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
ccgctaatat
tRNA gene sequence
GGAGAGATGGCAGAGTGGTTTATTGCACTTGTCTTGAAAACAAGAGAGGGTCATACCTCC
AGGGGTTCGAATCCCCTTCTCTCCTCCA
Downstream region at tRNA end position
cgaggtgtag
Secondary structure (Cloverleaf model)
>WENV170199989	Ser	TGA
                   t      TCCA cgaggtgtag
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     A - T          T A
                    T     T C C C C     A
      T G A        G      | | | | |     G
    G       G A C G       A G G G G     C
    G       + | | |                 T T
    T       T T G C
      T T A        A     AGAGGGTCATACCTCC
                    C - G
                    T - A
                    T - A
                    G - C
                    T - A
                  C       A
                  T       A
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK