The detailed information of tRNA gene sequence


Sequence ID>WENV170221304
Genome IDCEQA01065195
Search identical group
Phylum/Class[CEQA] marine metagenome genome assembly TARA_041_DCM_0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx)
Species
Start position on genome 11
End posion on genome 83
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ccccttttac
tRNA gene sequence
GGACCTTTAGCTCAGCGGTTAGAGCCCCCCGCTCATAACGGGTAGGTCCTCGGTTCAAAT
CCGAGAGGGTCCAttg
Downstream region at tRNA end position
ttttttacgg
Secondary structure (Cloverleaf model)
>WENV170221304	Met	CAT
                   c      Attg ttttttacgg
                     G - C
                     G - C
                     A - T
                     C - G
                     C - G
                     T + G
                     T - A          T A
                    T     G A G C C     A
      C G A        A      | | | | |     A
    G       C T C G       C T C G G     C
    G       | | | |                 T T
    T       G A G C
      T A          C     AGGTC
                    C   T
                    C - G
                    C - G
                    C - G
                    G - C
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK