The detailed information of tRNA gene sequence


Sequence ID>WENV170269124
Genome IDCERH01051610
Search identical group
Phylum/Class[CERH] marine metagenome genome assembly TARA_072_MES_0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx)
Species
Start position on genome 22883
End posion on genome 22807
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
ctctcaaaaa
tRNA gene sequence
GGTCCGGTAGTTCAGTTGGTTAGAACGCCTGCCTGTCACGCAGGAGGTCGAGGGTTCGAG
TCCCTTCCGGATCGCAA
Downstream region at tRNA end position
acccctcaca
Secondary structure (Cloverleaf model)
>WENV170269124	Asp	GTC
                   a      GCAA acccctcaca
                     G - C
                     G + T
                     T - A
                     C - G
                     C - G
                     G - C
                     G - C          T G
                    T     T T C C C     A
      T G A        A      + | | | |     G
    T       C T T G       G A G G G     C
    G       | | | |                 T T
    G       G A A C
      T T A        G     AGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    C - G
                  C       C
                  T       A
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK