| Sequence ID | >WENV170269160 |
| Genome ID | CERH01059760 |
| Phylum/Class | [CERH] marine metagenome genome assembly TARA_072_MES_0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
| Species | |
|
Start position on genome
|
1
|
|
End posion on genome
|
72
|
|
Amino Acid
|
Asp
|
|
Anticodon
|
GTC
|
|
Upstream region at tRNA start position
|
nnnnnnnnnn
|
|
tRNA gene sequence
|
GGGACTATAGTATAATGGTCAGTACAAGTGCCTGTCTAGCACATGATCCGAGTTCGATTC TCGGTAGTCTCGtta
|
|
Downstream region at tRNA end position
|
gagattcatt
|
| Secondary structure (Cloverleaf model) | >WENV170269160 Asp GTC
n Gtta gagattcatt
G - C
G + T
G - C
A - T
C - G
T - A
A - T T T
T G G C T C A
T A A A | | | | | G
G T A T G C C G A G C
G + | | | T T
T G T A C
C A A TGAT
A A
G - C
T - A
G - C
C - G
C A
T T
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |