The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0003
Genome IDBA000002
Search identical group
Phylum/ClassThermoproteota
SpeciesAeropyrum pernix K1 [BA000002]
Start position on genome 334925
End posion on genome 335001
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
gaggctgggc
tRNA gene sequence
GGGCCGGTAGCTCAGCCTGGAAGAGCGCCGCCCTCGCACGGCGGAGGCCCCGGGTTCAAA
TCCCGGCCGGTCCACCA
Downstream region at tRNA end position
gcgggccttc
Secondary structure (Cloverleaf model)
>At0003	Ala	CGC
                   c      ACCA gcgggccttc
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       C C G G G     C
    T       | | | |                 T T
    G       G A G C
      G A A        G     AGGCC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       C
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGCTCAGCCTGGAAGAGCGCCGCCCTCGCACGGCGGAGGCCCCGGGTTCAAA
TCCCGGCCGGTCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK