The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0004
Genome IDBA000002
Search identical group
Phylum/ClassThermoproteota
SpeciesAeropyrum pernix K1 [BA000002]
Start position on genome 372080
End posion on genome 372278
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
tgtgaaccgg
tRNA gene sequence
GCCGCGGTAGTATAGCCTGGACTAGTATGCGGGCCTGTCAAGCCCGTGACCCGGGTTCAA
ATCCCGGCCGCGGCGCCA
Downstream region at tRNA end position
ataatcctcg
Secondary structure (Cloverleaf model)
>At0004	Asp	GTC
                   g      GCCA ataatcctcg
                     G - C
                     C - G
                     C - G
                     G - C
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  T         T A T G       C C G G G     C
  G         + | | +                 T T
  G         G T A T
    A C T A        G     TGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A *
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGCGGTAGTATAGCCTGGACTAGTATGCGGGCCTGTCAagggccccgcctccgcccca
ccctcattctactacacgcttatcaggataaacagccgggcaaacgtttttaaccccgcc
gaaattcatactcttcccggggcggaggcgggcctgcggagAGCCCGTGACCCGGGTTCA
AATCCCGGCCGCGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK