The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0014
Genome IDBA000002
Search identical group
Phylum/ClassThermoproteota
SpeciesAeropyrum pernix K1 [BA000002]
Start position on genome 1176267
End posion on genome 1176379
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
ggccgggagt
tRNA gene sequence
GGGCCCGTAGCTCAGCCCGGCAGAGCGGCGGGCTTTTAACCCGTAGGTCCCGGGTTCAAA
TCCCGGCGGGCCCGCCA
Downstream region at tRNA end position
caacagcccc
Secondary structure (Cloverleaf model)
>At0014	Lys	TTT
                   t      GCCA caacagcccc
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       C C G G G     C
    C       | | | |                 T T
    G       G A G C
      G C A        G     AGGTC
                    G + T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCCGGCAGAGCGGCGGGCTTTTAACCCGTAGaggggagttgaggg
gcctcgtcctggccccgcggaaGTCCCGGGTTCAAATCCCGGCGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK