The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0027
Genome IDBA000002
Search identical group
Phylum/ClassThermoproteota
SpeciesAeropyrum pernix K1 [BA000002]
Start position on genome 340125
End posion on genome 340001
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
gcgaggaggt
tRNA gene sequence
GCCGGGGTGGCCGAGCGGCCCAAGGCGGCGGGCTCGAGACCCGTTGCCCCGCGAGGGGCG
CGCGGGTTCGAATCCCGCCCCCGGCGCCA
Downstream region at tRNA end position
gtttgtgggg
Secondary structure (Cloverleaf model)
>At0027	Ser	CGA
                   t      GCCA gtttgtgggg
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C G C C C     A
      C G A        G      | | | | |     G
    G       G C C G       G C G G G     C
    G         | | |                 T T
    C       A G G C
      C C A        G     TGCCCCGCGAGGGGCGC
                    G + T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G *
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTGGCCGAGCGGCCCAAGGCGGCGGGCTCGAGgtcggcaacaggggtttccgcg
ccgccgcacgagagACCCGTTGCCCCGCGAGGGGCGCGCGGGTTCGAATCCCGCCCCCGG
CGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK