The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0037
Genome IDBA000002
Search identical group
Phylum/ClassThermoproteota
SpeciesAeropyrum pernix K1 [BA000002]
Start position on genome 942051
End posion on genome 941976
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
tcgggccagt
tRNA gene sequence
AGCCGGGTCGTCTAGCGGCCCAGGATGCGGGGTTTTGGCCCCCGTGACCCGGGTTCGAAT
CCCGGCCCGGCTACCA
Downstream region at tRNA end position
tctttcacaa
Secondary structure (Cloverleaf model)
>At0037	Gln	TTG
                   t      ACCA tctttcacaa
                     A - T
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        C      | | | | |     G
    G       T C T G       C C G G G     C
    G       + | | +                 T T
    C       G G A T
      C C A        G     TGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    G - C
                  T       C
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCGGGTCGTCTAGCGGCCCAGGATGCGGGGTTTTGGCCCCCGTGACCCGGGTTCGAAT
CCCGGCCCGGCTACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK