The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0041
Genome IDBA000002
Search identical group
Phylum/ClassThermoproteota
SpeciesAeropyrum pernix K1 [BA000002]
Start position on genome 1163580
End posion on genome 1163492
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
ttgcataggt
tRNA gene sequence
GCCGGGGTGCCCGAGCGGTCCAAGGGGACGGGCTGGAGACCCGTTGCCCCGCGAGGGGCG
CGCGGGTTCGAATCCCGCCCCCGGCGCCA
Downstream region at tRNA end position
acattacagg
Secondary structure (Cloverleaf model)
>At0041	Ser	GGA
                   t      GCCA acattacagg
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C G C C C     A
      C G A        G      | | | | |     G
    G       G C C C       G C G G G     C
    G         | | |                 T T
    T       A G G G
      C C A        G     TGCCCCGCGAGGGGCGC
                    A - T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTGCCCGAGCGGTCCAAGGGGACGGGCTGGAGACCCGTTGCCCCGCGAGGGGCG
CGCGGGTTCGAATCCCGCCCCCGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK