The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0059
Genome IDDP000238
Search identical group
Phylum/ClassNitrososphaerota
SpeciesCenarchaeum symbiosum [DP000238]
Start position on genome 257294
End posion on genome 257368
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
gcagctcggc
tRNA gene sequence
GGGCTCATAGTCCAGTTCGGTCATGACGTCGCCCTTACACGGCGAAGATCCGGGGTTCAA
ATCCCCGTGGGCCCAtgt
Downstream region at tRNA end position
gtgatatttc
Secondary structure (Cloverleaf model)
>At0059	Val	TAC
                   c      Atgt gtgatatttc
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     C - G
                     A - T          T A
                    T     G C C C C     A
    T T G A        A      | | | | |     A
  C         C C T G       C G G G G     C
  G           | | |                 T T
  G         T G A C
    T C A          G     AGATC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  C       C
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCATAGTCCAGTTCGGTCATGACGTCGCCCTTACACGGCGAAGATCCGGGGTTCAA
ATCCCCGTGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK