The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0069
Genome IDDP000238
Search identical group
Phylum/ClassNitrososphaerota
SpeciesCenarchaeum symbiosum [DP000238]
Start position on genome 1696052
End posion on genome 1696125
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
tgccggcggc
tRNA gene sequence
GGGTCTGTGGCGCAGCCAGGTAGCGCACCGGACTTTTAATCCGGCTGTCGTGGGTTCGAA
TCCCACTAGACCCAccc
Downstream region at tRNA end position
atcctgacag
Secondary structure (Cloverleaf model)
>At0069	Lys	TTT
                   c      Accc atcctgacag
                     G - C
                     G - C
                     G - C
                     T - A
                     C - G
                     T - A
                     G + T          T A
                    T     C A C C C     A
      C G A        G      | | | | |     G
    C       C G C G       G T G G G     C
    A       | | | |                 T T
    G       G C G C
      G T A        A     CTGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGTCTGTGGCGCAGCCAGGTAGCGCACCGGACTTTTAATCCGGCTGTCGTGGGTTCGAA
TCCCACTAGACCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK