The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0074
Genome IDDP000238
Search identical group
Phylum/ClassNitrososphaerota
SpeciesCenarchaeum symbiosum [DP000238]
Start position on genome 3366
End posion on genome 3292
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
aaccgccgca
tRNA gene sequence
GGGCCTGTAGCTCAGCATGGATAGAGTGTTGGACTTCTAATCCAATGGTCAAGAGATCGA
AGCTCTTCAGGCCCGccc
Downstream region at tRNA end position
cacaaactat
Secondary structure (Cloverleaf model)
>At0074	Arg	TCT
                   a      Gccc cacaaactat
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     G - C          G A
                    T     T T C T C     A
    A C G A        A      | | | | |     G
  T         C T C G       A A G A G     C
  G         | | | +                 A T
  G         G A G T
    A T A          G     TGGTC
                    T - A
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCTGTAGCTCAGCATGGATAGAGTGTTGGACTTCTAATCCAATGGTCAAGAGATCGA
AGCTCTTCAGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK