The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0075
Genome IDDP000238
Search identical group
Phylum/ClassNitrososphaerota
SpeciesCenarchaeum symbiosum [DP000238]
Start position on genome 21853
End posion on genome 21779
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
taccaccgcg
tRNA gene sequence
GGGCCGGTGGTTTAGGGGTATAATGCTGCGTTCGCAACGCAGAAGTCGGGGGTTCAATTC
CCTCCCGGTCCACCA
Downstream region at tRNA end position
ctatacaggc
Secondary structure (Cloverleaf model)
>At0075	Ala	CGC
                   g      ACCA ctatacaggc
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T T
                    T     C T C C C     A
        G A        G      | + | | |     A
      G     T T T G       G G G G G     C
      G       | | +                 T T
      G     T A A T
        T A        G     AAGTC
                    C - G
                    T - A
                    G - C
                    C - G
                    G - C
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTGGTTTAGGGGTATAATGCTGCGTTCGCAACGCAGAAGTCGGGGGTTCAATTC
CCTCCCGGTCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK