The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0088
Genome IDDP000238
Search identical group
Phylum/ClassNitrososphaerota
SpeciesCenarchaeum symbiosum [DP000238]
Start position on genome 1695909
End posion on genome 1695832
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
gtacatctgc
tRNA gene sequence
GCCCTTGTAGTATAGCCCGGTCTAGAATTCGGCCCTGTCACGGCTGAGACGCGTGTTCAA
ATCCCGCCGAGGGCGCCA
Downstream region at tRNA end position
taaccaaaac
Secondary structure (Cloverleaf model)
>At0088	Asp	GTC
                   c      GCCA taaccaaaac
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     T + G
                     G - C          T A
                    T     C G C C C     A
    C C G A        A      | | |   |     A
  C         T A T G       G C G T G     C
  G         +   | +                 T T
  G         G A A T
    T C T A        T     AGAC
                    C - G
                    G + T
                    G - C
                    C - G
                    C - G
                  C       C
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCTTGTAGTATAGCCCGGTCTAGAATTCGGCCCTGTCACGGCTGAGACGCGTGTTCAA
ATCCCGCCGAGGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK