The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0093
Genome IDDP000238
Search identical group
Phylum/ClassNitrososphaerota
SpeciesCenarchaeum symbiosum [DP000238]
Start position on genome 1933052
End posion on genome 1932982
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
caggtgcgga
tRNA gene sequence
AGCCCGGTGGTGTAGCGGAAGCATGGGGGCCTTTGGAGCCCCCGACCCCAGTTCGAATCT
GGGCCGGGCTActa
Downstream region at tRNA end position
gtaatccagc
Secondary structure (Cloverleaf model)
>At0093	Gln	TTG
                   a      Acta gtaatccagc
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G G T C     A
        G A        G      | | | | |     G
      C     T G T G       C C C A G     C
      G     + | | +                 T T
      G     G C A T
        A A        G     CGAC
                    G - C
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCGGTGGTGTAGCGGAAGCATGGGGGCCTTTGGAGCCCCCGACCCCAGTTCGAATCT
GGGCCGGGCTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK