The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0098
Genome IDCP000493
Search identical group
Phylum/ClassThermoproteota
SpeciesHyperthermus butylicus DSM 5456 [CP000493]
Start position on genome 360308
End posion on genome 360385
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
gaaaagggct
tRNA gene sequence
GGGCCCGTCGTCTAGCCTGGTTAGGACGCCGCCCTTACACGGCGGAGGTCCGGGGTTCAA
ATCCCCGCGGGCCCACCA
Downstream region at tRNA end position
tgtacaacat
Secondary structure (Cloverleaf model)
>At0098	Val	TAC
                   t      ACCA tgtacaacat
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G C C C C     A
    C C G A        C      | | | | |     A
  T         T C T G       C G G G G     C
  G         + | | |                 T T
  G         G G A C
    T T A          G     AGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       C
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTCGTCTAGCCTGGTTAGGACGCCGCCCTTACACGGCGGAGGTCCGGGGTTCAA
ATCCCCGCGGGCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK