The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0099
Genome IDCP000493
Search identical group
Phylum/ClassThermoproteota
SpeciesHyperthermus butylicus DSM 5456 [CP000493]
Start position on genome 373519
End posion on genome 373640
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
gcgtgtgggt
tRNA gene sequence
GCCGGGGTGGCCGAGCGGTCCAAGGCGGTGGGCTCGAGACCCACTGCCCCGTAAGGGGCG
CGCGGGTTCAAATCCCGCCCCCGGCGCCA
Downstream region at tRNA end position
ccaaaaccat
Secondary structure (Cloverleaf model)
>At0099	Ser	CGA
                   t      GCCA ccaaaaccat
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C G C C C     A
      C G A        G      | | | | |     A
    G       G C C G       G C G G G     C
    G         | | |                 T T
    T       A G G C
      C C A        G     TGCCCCGTAAGGGGCGC
                    G - C
                    T - A
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G *
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTGGCCGAGCGGTCCAAGGCGGTGGGCTCGAGacccaggttttccggcttggta
ggggctgggagACCCACTGCCCCGTAAGGGGCGCGCGGGTTCAAATCCCGCCCCCGGCGC
CA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK