The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0116
Genome IDCP000493
Search identical group
Phylum/ClassThermoproteota
SpeciesHyperthermus butylicus DSM 5456 [CP000493]
Start position on genome 1612557
End posion on genome 1612634
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
gtagagaggc
tRNA gene sequence
GGGCCCGTAGCCTAGCCAGGATAGGGCGCCGGCCTTCTAAGCCGGTAGTCCGGGGTTCAA
ATCCCCGCGGGCCCGCCA
Downstream region at tRNA end position
ccctcatgat
Secondary structure (Cloverleaf model)
>At0116	Arg	TCT
                   c      GCCA ccctcatgat
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G C C C C     A
    C C G A        A      | | | | |     A
  A         T C C G       C G G G G     C
  G         + | | |                 T T
  G         G G G C
    A T A          G     TAGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCCTAGCCAGGATAGGGCGCCGGCCTTCTAAGCCGGTAGTCCGGGGTTCAA
ATCCCCGCGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK