The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0120
Genome IDCP000493
Search identical group
Phylum/ClassThermoproteota
SpeciesHyperthermus butylicus DSM 5456 [CP000493]
Start position on genome 1655763
End posion on genome 1655840
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
acaacatggt
tRNA gene sequence
GCCGCGGTAGTATAGCCTGGCCCAGTATGCGGGCCTGTCAAGCCCGTGACCCGGGTTCAA
ATCCCGGCCGCGGCGCCA
Downstream region at tRNA end position
atctcctcct
Secondary structure (Cloverleaf model)
>At0120	Asp	GTC
                   t      GCCA atctcctcct
                     G - C
                     C - G
                     C - G
                     G - C
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  T         T A T G       C C G G G     C
  G         + | | +                 T T
  G         G T A T
    C C C A        G     TGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGCGGTAGTATAGCCTGGCCCAGTATGCGGGCCTGTCAAGCCCGTGACCCGGGTTCAA
ATCCCGGCCGCGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK