The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0140
Genome IDCP000493
Search identical group
Phylum/ClassThermoproteota
SpeciesHyperthermus butylicus DSM 5456 [CP000493]
Start position on genome 1499066
End posion on genome 1498990
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
gatggggtct
tRNA gene sequence
GGGCCGGTAGCTCAGCCTGGCAGAGCGGCGGGCTTTTAACCCGTAGGTCCCGGGTTCAAA
TCCCGGCCGGCCCGCCA
Downstream region at tRNA end position
caacacctcc
Secondary structure (Cloverleaf model)
>At0140	Lys	TTT
                   t      GCCA caacacctcc
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       C C G G G     C
    T       | | | |                 T T
    G       G A G C
      G C A        G     AGGTC
                    G + T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGCTCAGCCTGGCAGAGCGGCGGGCTTTTAACCCGTAGGTCCCGGGTTCAAA
TCCCGGCCGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK